Processing...

Vavouto Bay Metabarcoding

Tools Click here to view this collection in the new DAP user interface

show summary fields  |   show all    
Tools



About this Collection

Vavouto Bay Metabarcoding


18S rDNA, 16S rDNA, and diatom 18S v4 rDNA amplicons from sediment DNA collected from Vavouto Bay New Caledonia.


Environmental Impact Assessment


https://doi.org/10.25919/5da80af25e87c


01 Jul 2017


01 Jan 2019


Megan Gillmore
Megan.Gillmore@csiro.au

metabarcoding Nickel eDNA sediment


The DNA was amplified using polymerase chain reaction (PCR) and three different sets of primers to target different components of the benthic community composition. The eukaryotic community was determined by PCR of the 18S rDNA gene, performed using the universal primers All18SF (5’-3’: TGGTGCATGGCCGTTCTTAGT) and All18SR (5’-3’: CATCTAAGGGCATCACAGACC) (Hardy et al., 2010). The prokaryotic community was determined by PCR of the 16S rDNA gene, performed using 515f (5′-3’: GTGYCAGCMGCCGCGGTAA) (Baker et al., 2003; Quince et al., 2011) and 806r (5′-3’: GGACTACNVGGGTWTCTAAT) (Apprill et al., 2015). The diatom community was determined by PCR of the SSU (18S V4) rDNA gene F- GCGGTAATTCCAGCTCCAATAG and R – CTCTGACAATGGAATACGAATA (Zimmerman et al., 2011) (Zimmermann et al., 2011). A summary of the thermal cycling profiles for each primer set is provided in supplementary Table S1. For all PCRs, amplification was performed in a total volume of 50 µL with 25 µL of AmpliTaq® Gold 360 Master Mix (Applied Biosystems, USA), 18 – 21 µL Water (Molecular Biology Reagent, Sigma Aldrich, USA), 1 µL of 10 µM forward and reverse primers, and 2 – 5 µL of genomic DNA. All PCRs were run with positive DNA controls: mussel (Mytilus) and polychaete (Capitellidae) DNA for eukaryotic 18S rDNA PCR, Halothermothrix for prokaryotic 16S rDNA PCR, and Phaeodactylum for the diatom specific PCR; and a negative control of 2 – 5 L of PCR grade Water (Molecular Biology Reagent, Sigma Aldrich, USA). Success of PCR amplification was confirmed using a microchip electrophoresis system (MultiNA, Shimadzu, Japan). PCR products were then pooled into a single tube (separate tube for each set of primers) and were then purified using the QIAquick PCR purification kit (Qiagen). The concentration and purity of the purified PCR products were determined as reported above for DNA. Sequencing was performed by the Ramaciotti Centre for Genomics (UNSW, Australia). The three pooled samples of 18S rDNA, 16S rDNA, and diatom 18S v4 rDNA amplicons were prepared with Illumina Tru-seq PCR-free library preparation kit and sequenced over one Illumina MiSeq run at 2x250 base-pair paired-end.


Megan Gillmore


Creative Commons Attribution-Noncommercial-No Derivatives 4.0 International Licence


CSIRO (Australia)


Gillmore, Megan; Gissi, Francesca; Stauber, Jenny; Golding, Lisa; Stephenson, Sarah; Greenfield, Paul; Chariton, Anthony; Jolley, Dianne (2019): Vavouto Bay Metabarcoding. v1. CSIRO. Data Collection. https://doi.org/10.25919/5da80af25e87c


All Rights (including copyright) CSIRO 2019.


The metadata and files (if any) are available to the public.

show all

Location Details

20°0′0″ S


164°0′0″ E


WGS84


About this Project

NiPERA


This project has investigated the toxicity of nickel to tropical marine biota. The data uploaded here presents findings on the effect of nickel to adult corals and their microbiome.


Jenny Stauber


Analysis of sediment nickel concentrations and benthic community composition


The objectives of the study were to: (1) examine the influence of sediment nickel concentrations on benthic community composition; (2) identify associations between other key environmental variables and benthic community composition; (3) determine if protective thresholds for benthic taxa along a nickel-contaminated sediment gradient can be derived... more


Analysis


Illumina miseq and ICP AES


Megan Gillmore


Francesca Gissi


Jenny Stauber


Lisa Golding


Sarah Stephenson


Paul Greenfield


Anthony Chariton


Dianne Jolley


Similar collections

  • Eukaryote Metabarcoding from Copper Mescosm Experiment....
    view

Others were also interested in

  • Ecogenomic characterisation of sediment microbial community responses over a spiked uranium gradient....
    view
  • Eukaryote Metabarcoding from Copper Mescosm Experiment....
    view
  • Eukaryote Composition SE Queensland 2010....
    view
  • Benchmarking environmental footprints of agricultural production in Huang-Huai-Hai Plain, China....
    view